SciELO - Scientific Electronic Library Online

 
vol.28 issue2Reformulation and characterization of grapefruit and banana jam made in the district of Coronel Oviedo, department of Caaguazú, ParaguayInteraction of seed vigor and dose of nitrogen in cover on wheat yield author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Journal

Article

Indicators

  • Have no cited articlesCited by SciELO

Related links

Share


Revista de la Sociedad Científica del Paraguay

Print version ISSN 0379-9123On-line version ISSN 2617-4731

Rev. Soc. cient. Parag. vol.28 no.2 Asunción Dec. 2023

https://doi.org/10.32480/rscp.2023.28.2.10 

ARTÍCULO ORIGINAL

Record of Etiella zinckenella (Treitschke) affecting soybeans in Itapúa, Paraguay

Registro de Etiella zinckenella (Treitschke) afectando cultivo de soja en Itapúa, Paraguay

José A. Schlickmann-Tank1 
http://orcid.org/0000-0001-5488-6255

Liliana Noelia Talavera-Stefani1  2 
http://orcid.org/0000-0002-3249-2930

Cinthia Noemi Burgos-Cantoni2 
http://orcid.org/0009-0008-7917-2206

Jazmin Yeruti Mongelós-Franco2 
http://orcid.org/0000-0002-2866-2204

Guillermo Andres Enciso-Maldonado1  3 
http://orcid.org/0000-0002-9528-7627

1Centro de Desarrollo e Innovación Tecnológica (CEDIT). Hohenau, Itapúa, Paraguay.

2Universidad Nacional de Itapúa, Facultad de Ciencias y Tecnologías Encarnación. Itapúa, Paraguay.

3Universidad Católica “Nuestra Señora de la Asunción, Unidad Pedagógica Hohenau. Hohenau, Itapúa, Paraguay.


ABSTRACT

During the 2021/2022 soybean production season in Itapúa, Paraguay, the presence of Etiella zinckenella (Treitschke) caterpillars affecting soybean pods in the country was documented. The observations were made amidst a widespread drought that adversely affected soybean production. Caterpillars were collected from pods that exhibited signs of pest entry. Morphological characterization of the collected specimens matched the descriptions provided in taxonomic keys for E. zinckenella larvae. Molecular identification through DNA extraction and sequencing confirmed the identity of the pest as E. zinckenella, exhibiting a 96% similarity with known accessions of the species in the GenBank database. As a challenging pest to control, efforts should be directed towards evaluating the economic and damage thresholds caused by E. zinckenella, assessing resistance in soybean varieties used in Paraguay, and investigating the efficacy of biological and chemical insecticides. These findings can contribute to the development of integrated management strategies for effectively mitigating the impact of this pest on soybean production in Paraguay.

Keywords: entomology; Glycine max, harvesting, pests.

RESUMEN

Durante la temporada de producción de soja 2021/2022 en la región de Itapúa, Paraguay, se documentó la presencia de orugas Etiella zinckenella (Treitschke) afectando las vainas de soja en el país. Las observaciones se realizaron en medio de una sequía generalizada que afectó negativamente a la producción de soja. Las orugas se recolectaron de las vainas que mostraban signos de entrada de plagas. La caracterización morfológica de los especímenes recolectados coincidió con las descripciones proporcionadas en claves taxonómicas para las larvas de E. zinckenella. La identificación molecular a través de la extracción y secuenciación de ADN confirmó la identidad de la plaga como E. zinckenella, exhibiendo un 96% de similitud con las accesiones conocidas de la especie en la base de datos GenBank. Como plaga difícil de controlar, los siguientes esfuerzos deben dirigirse a evaluar los umbrales económicos y de daño causados por E. zinckenella, evaluar la resistencia en las variedades de soja utilizadas en Paraguay e investigar la eficacia de los insecticidas biológicos y químicos. Estos hallazgos pueden contribuir al desarrollo de estrategias de manejo integrado para mitigar de manera efectiva el impacto de esta plaga en la producción de soja en Paraguay.

Palabras clave: cosecha; entomología; Glycine max; plaga

INTRODUCTION

The pod borer Etiella zinckenella (Treitschke) (Lepidoptera: Pyralidae) is considered a cosmopolitan pest. This species feeds mainly on fabaceae seeds, including peas (Pisum sativum), common bean (Phaseolus vulgaris) and soybean (Glycine max)1.

The population of E. zinckenella increases in dry and warm seasons, which also allows a higher incidence in crops2. Furthermore, this pest can survive during the winter on host crops such as Crotalaria sp.3.

In addition, E. zinckenella is considered a difficult-to-control pest when soybeans are in the pod stage, where insecticide applications are made without considering their effectiveness or economic thresholds 4. When the attacks of E. zinckenella to the soybean crop are severe, the losses can reach to 80%, when control tactics of this pest are not carried out 5) .

In Paraguay, this pest was recorded in Villarrica in 19566 and later a mention was made of its presence in Paraguay7, so the aim of this work was to document the record of this insect attacking soybean crops in Itapúa department, Paraguay.

During the 2021/2022 soybean production season, the presence of E. zinckenella caterpillars was observed in Itapúa (Paraguay) fields (Table 1). This season was characterized by the occurrence of a generalized drought in the country, which affected soybean production8. Caterpillars were collected from individual pods of soybean plants previously identified with pest entry holes (Figure 1). Subsequently, they were preserved in 70% ethanol in the Multiple Uses Laboratory of the Technological Development and Innovation Center (CEDIT) in Natalio, Itapúa (Paraguay), where morphological characterization was carried out using taxonomic keys of immature stages of the Pyralidae family9 and keys to immature stages of lepidoptera10.

Table 1. Location  and date of observation of Etiella zinckenella in soybean fields in Itapúa, Paraguay.  

Location Geographical coordinates Observation date
S W
Bella Vista 27°02'07.3" 55°31'38.5" 10/12/2021
Capitán Meza 26°52'11.2" 55°18'53.9" 10/12/2021
Edelira 26°43'50.4" 55°17'14.1" 15/12/2021
Natalio 26°40'33.7" 55°07'53.9" 20/01/2022
Pirapó 26°46'38.3" 55°29'35.5" 10/12/2021
San Rafael del Paraná 26°32'04.4" 54°56'40.4" 11/02/2022
Tomás Romero Pereira 26°34'49.5" 55°14'09.0" 11/02/2022

Figure 1 Damage caused by Etiella zinckenella. (a) perforated pods; (b, c) soybeans with damage and caterpillar feces; (d) Etiella zinckenella caterpillar feeding. 

The DNA extraction and molecular identification were carried out in the Molecular Biology Laboratory of the Faculty of Science and Technology at the National University of Itapúa, Encarnacion, Itapúa, Paraguay. The larvae morphology detected in soybean pods and seeds concord with that described by other researchers9-12 for E. zinckenella larvae, presenting the eighth-grade blowhole, abdominal segment at the same level as the previous ones, three ventral setae can be seen from the third to the sixth abdominal segment, a bright ring around the SD1 bristle on the eighth abdominal segment, with three setae on the lateral group of the ninth abdominal segment and thoracic plate with a characteristic pattern for the species (Figure 2).

Figure 2 Morphological characteristics of Etiella zinckenella observed in Paraguayan soybean fields. (a) Chest plate; (b) Lateral detail of the last abdominal segments; (c) Lateral view of the head and thorax; (c) Adult captured in soybean culture. Bars = 1mm. 

Genomic DNA was extracted from the thorax and head of one adult, with The Wizard® Genomic DNA Purification Kit (Promega). To verify the identity, the barcoding region of the mitochondrial gene cytochromeoxidase 1 (CO1) was amplified with the following primers: LepF1: ATTCAACCAATCATAAAGATATTGG and LepR1: TAAACTTCTGGATGTCCAAAAAATCA13. The resultant amplicons were sequenced at Macrogen (Seoul, Republic of Korea), and the consensus sequence was compared use with the GenBank database with the Blastn tool. Obtaining a consensus sequence of 599 bp, which presented a high percentage of identity (96%) with accesses of the species E. zinckenella.

This is the first record of E. zinckenella affecting pods in soybeans fields in Itapua, Paraguay. Future investigations could focus on evaluating the loss caused by this pest to determine economic and damage thresholds, as well as determining resistance in the varieties used in Paraguay and evaluating the effectiveness of biological and chemical insecticides with the aim of making proposals for their management integrated from this plague.

ACKNOWLEDGMENTS

We thank to the farmers of Itapúa, Paraguay, who allowed us to enter their soybean fields to collect for this study.

REFERENCES

1. Kuswantoro H, Bayu MSYI, Baliadi Y, Tengkano W. Resistance of Advanced Soybean Lines to Pod Borrer (Etiella zinckenella Treitschke). Biosaintifika. 2017; 9, 317-324. [ Links ]

2. Vaibhav V, Singh G, Deshwal R, Maurya NK. Seasonal incidence of major pod borers Etiella zinckenella (Treitschke) and Helicoverpa armigera (Hubner) of vegetable pea in relation with abiotic factors. J Entomol. Zool. Stud. 2018; 6:1642-1644. [ Links ]

3. Córdova-Ballona L, del Carmen Lagunes-Espinoza L, de la Cruz-Pérez A, Rincón-Ramírez JA, Sánchez-Soto S. Insectos asociados a Crotalaria longirostrata Hook. & Arn. (Fabales: Fabaceae) en La Chontalpa, Tabasco, México.Acta Agrícola y Pecuaria.2022; 8, e0081002. [ Links ]

4. Le Thu N, Le Thi Minh T, Pham Bich N, Trinh Thi Thu H, Dong Van Q, Ngo Dinh B, Chu Hoang H, Hoang H, Nguyen Van D. Detection of a novel Cry2Ab toxin against Etiella zinckenella Treitschke from the Bacillus thuringiensis serovar canadensis SP142 strain. Plant Protect Sci. 2022; 52:158-169. https://doi.org/10.17221/59/2021-PPSLinks ]

5 . Ginting S, Pujiwati H, Djoko UK, Murcitro BG, Susilo E. The attack of Etiella zinckenella Treitschke on soybean varieties. Journal of Tropical Plant Pests and Diseases. 2022; 22, 83-89. [ Links ]

6 . Heinrich C. American moths of the subfamily Phycitinae. Bulletin of the United States National Museum; 1956; 207: 1-581. (Consultado en el "Checklist of American Phycitinae", pág. 320, entrada 207). [ Links ]

7 . Pastrana JA., Braun K. Los lepidópteros argentinos: sus plantas hospedadoras y otros sustratos alimenticios (334 p.). Buenos Aires: Sociedad Entomológica Argentina; 2004. [ Links ]

8 . Programa de las Naciones Unidas para el Desarrollo PNUD. Paraguay, impactos económicos y sociales de la sequía. Asunción, Paraguay. 2022. [ Links ]

9 Solis MA. Key to selected Pyraloidea (Lepidoptera) larvae intercepted at U.S. ports of entry: revision of pyraloidea. in: “Keys to some frequently intercepted lepidopterous larvae” by Weisman, 1986. P Entomol Soc Wash. 2009; 101:645e86. [ Links ]

10 .Artigas JN. Entomología Económica (Insectos de Interés Agrícola, Forestal, Médico y Veterinario (nativos, introducidos y susceptibles de ser introducidos). Editorial Universidad de Concepción; 1994. [ Links ]

11 . Urra F. Las polillas pirálidas. Servicio Nacional del Patrimonio Cultural; 2018. https://www.mnhn.gob.cl/613/w3-article-87533.html?_noredirect=1 . [ Links ]

12. Ampuero J, León D. Primer registro de Etiella zinckenella (Treitschke) (Lepidoptera, Pyralidae) afectando semillas de Alstroemeria spp. nativas en Valparaíso, Chile. Chilean journal of agricultural & animal sciences 2021; 37, 112-116. [ Links ]

13. Emery VJ, Landry JF, Eckert CG. Combining DNA barcoding and morphological analysis to identify specialist floral parasites (Lepidoptera: Coleophoridae: Momphinae: Mompha).Molecular Ecology Resources. 2009; 9, 217-223. [ Links ]

AUTHOR CONTRIBUTIONS

JAST conceived the research and designed the sampling, collected the field data and carried out the morphometric studies; LNTS developed the laboratory methodology and analyzed the molecular data; CNBC carried out the investigation, specifically, processing the samples in the laboratory; JYMF carried out the research, specifically processing the samples in the laboratory, also analyzed molecular data; GAEM supervised and led the planning and execution of the research, also prepared the published work, specifically writing the initial draft (including a substantial translation). All authors reviewed and approved the final version of the manuscript.

DECLARATION OF CONFLICTS OF INTEREST

The authors declare that they have no conflict of interest with respect to this research article.

RESPONSIBLE EDITOR

Nélida Soria

Funding sources: None.

Received: June 29, 2023; Accepted: September 11, 2023

Author for correspondence: gui77eenciso@gmail.com

Creative Commons License This is an open-access article distributed under the terms of the Creative Commons Attribution License